Skip Ribbon Commands
Skip to main content
Thứ 6, 15/04/2016 | 23:56 GMT+7


Chẩn đoán xét nghiệm phát hiện virus mới gây bệnh trên cá rô phi


Một nghiên cứu được công bố trên mBio, tạp chí trực tuyến của Hội Vi sinh vật học Hoa Kỳ (the American Society for Microbiology), nhóm nghiên cứu chỉ rõ loại virus Tilapia Lake Virus (TiLV) là thủ phạm làm cá rô phi chết sớm ở Ecuador và Israel những năm gần đây.

Virus Tilapia lake (TiLV) là một virut RNA mới giống Orthomyxovirus; đã được báo cáo là một virus mới xuất hiện gây các triệu chứng về gan ở cá rô phi tại Israel, Ecuador, Colombia và Ai Cập (Ferguson và cộng sự, 2014; Eyngor và cộng sự, 2014; Bacharach và cộng sự, 2016; Del-Pozo và cộng sự, 2017; Fathi và cộng sự, 2017). Bệnh này gây chết với tỷ lệ lớn lên đến 90% ở cá rô phi nuôi và được coi là mối đe dọa tiềm ẩn đối với nuôi cá rô phi toàn cầu (Eyngor và cộng sự, 2014).

Mới đây, nhóm nghiên cứu tại Thái Lan (Ha DT và cộng sự, 2017) đã phát triển phương pháp semi-nested RT-PCR phát hiện TiLV gây bệnh trên cá rô phi tại các trang trại nuôi cá rô phi ở Thái Lan như sau:

  1. a) Trình tự cặp mồi:

Tên cặp mồi

Trình tự (5’- 3’)

Kích thước (bp)

Tham khảo

First RT-PCR

Nested ext-1

ME1

TATGCAGTACTTTCCCTGCC

GTTGGGCACAAGGCATCCTA

415

Eyngor et al. 2014,

Tsofack et al. 2016

Semi-nested PCR

7450/150R/ME2

ME1

TATCACGTGCGTACTCGTTCAGT

GTTGGGCACAAGGCATCCTA

250

Eyngor et al. 2014,

Tsofack et al. 2016

  1. b) Điều kiện phản ứng:

Step

Reagents

Volume (μl)

Thermocycler parameters

First RT-PCR

100-400 ng of total RNA 2X buffer

10 μM primer Nested ext-1

10 μM primer ME1

SuperScript One-Step

RT/Platinum Taq mix (Invitrogen)

Sterile water

Total reaction

1.5

12.5

1

1


0.5

8.5

25

Reverse transcription

50°C, 30 min

Denaturation 94°C, 2 min 25 cycles of

- Denaturation 94°C, 30 s

- Annealing 60°C, 30 s

- Extension 72°C, 30 s

Final 72°C, 5 min

Semi-nested PCR

The first PCR product

10X buffer

10 mM dNTP

10 μM primer 7450/150R/ME2

10 μM primer ME1

Taq DNA polymerase (5 units/μl)

Sterile water

Total reaction

1

2

0.4

0.5

0.5

0.2

15.4

20

Denaturation 94°C, 2 min 25 cycles of

- Denaturation 94°C, 30 s

- Annealing 60°C, 30 s

- Extension 72°C, 30 s

Final 72°C, 5 min

 

  1. c) Kết quả điện di:

 

 

Ghi chú:  

(M) DNA Marker;

(-) Đối chứng âm;

(++) Đối chứng dương;

(+) Mẫu dương tính;

(*) Sản phẩm khác.

Thành công của nghiên cứu này sẽ giúp người nuôi cá rô phi phát hiện virus gây bệnh và thực hiện các biện pháp nhằm hạn chế sự lây lan của bệnh.